Web Analytics Made Easy - StatCounter

Synthetic Primer Tenders

Get complete information related to latest Synthetic Primer Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Synthetic Primer Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Synthetic Primer Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39847217 Due date: 17 Apr, 202517 Apr, 2025 NA
Tender For supply of bricks , 10mm stone aggregates , 20mm stone aggregates , 40mm stone aggregates , coarse sand , fine sand , moorum filling material , portland cement , vitrified floor tile 60x60 cm , white cement , paint primer , distemper paint , acrylic smooth exterior paint , synthetic enamel paint , cement base wall care putty , roller brush , 100mm brush , tmt bar 12 mm 880 kg and 08 mm 250kg , binding wire , rectangular hallow section , gi plan sheet barge board upto 300 mm and gutter 600 mm over all girth , cgi precoated galvanised iron sheet , self screw , welding rod , 4 inch cutting blade , iron angle frame for door angle size 40x40x6 mm , wooden door 35 mm thick shutters , iron angle window with grill bar and glass panes fix with silicon complete all fitting accessories , tower bolt , handle , aldrop , calcium silicate reinforced with fibre and natural filler false ceiling tiles of size 595x595 mm , 4 mm dia steel wire rope lock u clamp set pu coated , aluminium with stainless steel ss coating 4 ftx 3 mtr mosquito net wire and meshs , 1.5 sqmm single core wire , 2 .5 sqmm single core wire , 6 amp switch , 6 amp socket 5-pin , 16 amp switch , 16 amp socket , ceiling rose , 1200mm ceiling fan , modular fan regulator , led tube light 20 watt , 16 amp single pole mcb , 32 amp double pole mcb , mcb box 8 way , pvc board size 9x8 inch , 25 mm casing capping , 25 mm casing capping clip , screw 1.5 inch , 6 mm pvc gatti , pvc 6 way board , insulation tap , contractor mason labour and electrician charges for construction of barrack size 20 feet x 60 feet and 5 feet veranda with brick wall plastering floor tiling false ceiling work etc bid number/ & ( * ) : gem/2025/b/6091302 dated/ + : 27-03-2025 bid document/ 3 3 1 / 43

Central Government/Public Sector

CTN :39858859 Due date: 18 Apr, 202518 Apr, 2025 NA
Tender For supply of bricks , 10mm stone aggregates , 20mm stone aggregates , 40mm stone aggregates , coarse sand , fine sand , moorum filling material , portland cement , floor tile 60x60 cm , white cement , paint primer , distemper paint , acrylic smooth exterior paint , synthetic enamel paint , wall care putty , roller brush , 100mm brush , tmt bar , binding wire , rectangular hallow section pipe , gi plan sheet, barge board upto 300 mmand gutter 600 mm over all girth , galvanised iron sheet , self screw , welding rod , 4 inchcutting blade , iron angle frame for door angle size 40x40x6 mm , wooden door 35 mm thick shutters , iron angle window size with grill bar and glass panes fix with silicon complete all fitting accessories , tower bolt , handle , aldrop , false ceiling , 4 mm dia steel wire rope lock u clamp set pu coated , aluminium with stainless steel ss coating 4 ftx 3 mtr mosquito net wire and meshs , 1.5 sqmm single core wire , 2.5 sqmm single core wire , 6 amp switch , 6 amp socket 5-pin , 16 amp switch , 16 amp socket , modular fan regulator , led tube light 20 watt , 16 amp single pole mcb , mcb box 8 way , 25 mm casing capping , 25 mm casing capping clip , screw 1.5 inch , 6 mm pvc gatti , pvc 6 way board , insulation tap , contractor mason labour and electrician charges for construction of barrack size 20 feet x 60 feet and 5 feet veranda with brick wall plastering floor tiling false ceiling work etc

CTN :39858836 Due date: 18 Apr, 202518 Apr, 2025 NA
Tender For supply of cement 43 grade opc , coarse sand free from vegetation , coarse aggregate 20mm graded , coarse aggregate 40mm graded , hardcore 63 to 90 mm graded , aac blocks of size 600x200x150mm , mild steel bars of size 8 mm dia , mild steel bars of size 10 mm dia , mild steel bars of size 12mm dia , mild steel bars of size 16 mm dia , ms binding wire , wooden plank for shuttering ii class wood of size 3.0 x0.3 x0.026 m , acrylic emulsion paint of approved brand on new concrete surface , wooden scantling various size , oil bound distemper washable quality , wooden log for prop , synthetic enamel paint , painting brush 4 inch , nails various sizes , ms rhs of size 96x48x4 , ms plate of size 8mm thick , ms nuts and bolts of length 100mm fully thread suitable for 10 mm dia , ppgi sheet 0.55 mm thick of size10ft x3 ft , ppgi ridge sheet of 0.63mm thick of 90cm wide , self taping steel screw half thread with rawl plug , hdpe sand bags og colour of size 0.75x0.375x0.15 , anti corrosive red oxide zinc chromate primer , white lime , waterproofing compound , cement based paint , door of size 3x2.1 mtr double leaf , ventilator with grill 600x450mm , birla white wall care putty , ceramic tiles of size 600x600mm , white cement , curtain arrangement , movable pvc panel 12mm thick , app based polymeric membrane , priming surface and applying bitumen , brick sub class b , three phase 1.2 hp monoblock pump 430 volt complete , mild steel bars of size 12mm dia , air termination single pointed aluminium rod 12 mm dia and 300 mm long , testing point terminal block make of gun metal , aluminium strips 25 x 3.0 mm , galvanized iron strip 32 x 6 mm , earthing plate 600 x 600 x 6 mm , charcoal , salt normal , ci earth pit cover of size 300 x 300 x 6 mm , nut bolt 6mm dia 30 mtr dia with check nut and washer , gi pipe 40mm dia mtr 2.5 mtr , insulating pvc block 75x75x30 mm with insulating clamp nut and bolt , cement opc 43 grade packed , coarse sand free from vegetation , coarse aggregate 40mm graded , stone boulder 99 inch to 12 inch , pvc pipe 75mm dia 3 mtr long , distribution box 8 way double door spn 240 volts , mcb spn 240 volts 32 amps , mcb sp 240 volts 6 to 32 amps , pvc tape 19mm wide 5m long , cable pvc insulated electric 1.5 sqmm single core , cable pvc insulated of size 2.5 sqmm single core , cable pvc insulated 4 sqmm single core , pvc casing capping 1 inch , pvc casing capping 3 by 4 inch , switch piano type 5a 230v flush type one way , led tube light fittings 15w 230v , led mirror lights 1 feet 5 watts , screw 6x19mm isi marked , pvc switch board 6 inch by 6 inch , pvc switch board 7 inch by 4 inch , pvc switch board 8 inch by 10 inch , pvc l bend and t , modular switch socket combination 15a 230v , service bracket 40mm dia , service cable insulated aluminium conductore 10 sqmm 2 core , ceiling rose three terminal , led bulk head fittings high pressure die cast , pvc flexible wire copper conductor multi strandard , pvc flexible conduit pipe 15mm dia , pvc round or square block , exhaust fan of 230 volts 300mm seeep , fire exitingusher of 1kg capacity of dry powder type , earthing plate 600x600x6mm gi , ci earth pit cover of size 300x300x6mm with angle iron , funnel fitted with 20mm dia gi pipe 1.5m long , gi wire 4mm dia for earthing. , charcoal. , salt normal. , individual standalone plastic body smoke alarm , individual standalone plastic body heat alarm , fire ball extinguisher of 1.3 kg wt , study chair of size length 56 cm , study table , looking mirror of selected quality frameless , bid details/ 2 / 70 peg set of six , water dispenser of 230 v 500 watts , manual kero room heater 60cm height , labour charge

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government And Public Sector

CTN :39832460 Due date: 16 Apr, 202516 Apr, 2025 34.90 Lacs
Tender For repairs to excavated remains in outer side of mint areas at fatehpur sikri, agra -supply of materials - supply of 1st quality well burnt unslaked lime in a sealed air tight bags including transportation lead, lift & stacking at site. (rate including g.s.t.), supply of fine crushed brick surkhi obtained from 1st class well burnt bricks including transportation lead, lift & stacking at site for measurement. (rate including g.s.t.), supply of sieved coarse sand (screened) free from lumps, dust, silt & organic impurities. including transportation lead, lift & stacking at site for measurement. (rate including g.s.t.), belgiri (rate including g.s.t.)., gum babool (rate including g.s.t.)., gur (rate including g.s.t.)., r.r. stone nominal size (rate including g.s.t.), red sand stone 65mm thick (rate including g.s.t.)., brick ballast of lakhori brick/ 1st class brick 40mm size (rate including g.s.t.), earth work in excavation by manual means in foundation trenches, including dressing of sides and ramming of bottoms, getting out the excavated soil and disposal of surplus excavated soil as directed, within a lead of 50 m. (rate including g.s.t.), providing and laying in position cement concrete of specified grade 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size). (rate including g.s.t.), random rubble masonry with hard stone in foundation and plinth in cement mortar 1:6 (1 cement : 6 coarse sand) including t & p, material, scaffolding etc complete. (rate including g.s.t.), providing coursed rubble pathway with hard stone with :cement mortar 1:6 (1 cement : 6 coarse sand) inluding supply of all materials labour t&p etc. required for proper completion of work. (rate including g.s.t.), providing & fixing m.s. grill of required pattern with angle iron frames (40x40x6)mm size graded with square bars 12mm size 10 cm c/c pointed at the top with extra curved bar and each frame with (40x40x6)mm. size horizontal hold fast welded with lower posts and fixing angle iron vertical post (50x50x6)mm size and nut bolts including cutting fabricating welding etc. complete. (rate including g.s.t.), providing and fixing of r.s. joist (175x85x5.80)mm for hanging of m.s. gate including priming at diwan-e-am, fatehpur sikri, agra. (rate including g.s.t.), pdg. 18mm cement plaster in two coats under layer 12mm thick cement plaster 1:5 (1 cement : 5 c.sand) and a top layer 6mm thick cement plaster 1:3 (1cement : 3 c.sand) finished rough with sponge. (rate including g.s.t.), pointing on stone masonry with cement mortar (1 cement, 3 c.sand) mixing with coloring pigment, t & p, scaffolding etc complete. (rate including g.s.t.), steel work in built up tubular trusses etc., including cutting, hoisting, fixing in position and applying a priming coat of approved steel primer, including welding and bolted with special shaped washers etc. complete. electric resistance or induction butt welded tubes. (rate including g.s.t.), painting with synthetic enamel paint of approved brand and manufacture of required colour :two or more coats on new work. (rate including g.s.t.), red sand stone 75mm thick top fixing in m.s. iron frame/ pathway fine dressed on all exposed surface in required pattern and all material labour t&p etc. required for porper completion of work. (rate including g.s.t.), disposal of moorum/building rubbish/ malba/ similar unserviceable, dismantled or waste material by mechanical transport including loading, transporting, unloading to outside of municipal limits for lead upto 10 km for all lifts, complete as per directions of engineer-in-charge. (rate including g.s.t.), providing and fixing of red sand stone benches having 4 legs of size (0.25x0.25x0.45)m with simple moldings and 8cm thick red sand stone top size 1.50x0.60 m as per design and matching to the existing pattern at site. (rate including g.s.t.), hiring charges of electric / diesel mixer grinder for mortar with operator and fuel etc. co

CTN :39832806 Due date: 03 Apr, 202503 Apr, 2025 5.14 Lacs
Tender For construction of higher primary school kitchen shed in mallekatte village anaji gp davanagere - broken stone aggregate 40 mm size (dvggp), broken stone aggregate 20 mm size (dvggp), broken stone aggregate 12 mm to 10 mm size (dvggp), coarse sand (zone iii) (dvggp), portland cement (dvggp), mixer (concrete) - 1 cum capacity (dvggp), size stone 20 x 20 x 25 cms (dvggp), mixer (concrete small used in culvert) (dvggp), plasticizer / super plasticizer (dvggp), hom of vibrator 0.71 days (dvggp), formwork, centering & scaffolding for columns & piers - 70% (dvggp), formwork, centering & scaffolding for beams & lintels of building - 60% (dvggp), formwork, centering & scaffolding for roof (straight & arched) - 50% (dvggp), tmt bars fe 500 (dvggp), binding wire (dvggp), rcc pipe np2 class 900 mm dia, 300 mm length (internal) (dvggp), solid concrete block (40x15x20 cms)- 5.00 n/sqmm (dvggp), mason class i (with tools) (dvggp), alluminium tower bolt - 20 cm (dvggp), thick plain glass 5.50 mm (dvggp), fabricator (dvggp), ms sheet 1 mm thick (dvggp), gusset plates 3.15 mm thick (dvggp), angle iron 40x40x6mm (dvggp), water proofing cement paint (dvggp), primer (dvggp), ceramic tiles 30 x 30 cms (dvggp), vitrified tiles 600x600 mm (dvggp), cudddapah slab 2.5 cms thick (dvggp), granite sink 23cm thick (dvggp), polyenthylene water storage tank of specified capacity l (dvggp), white vitreous china clay flat back wash basin size 630x450mm (dvggp), cp brass chain with plug (dvggp), brass stop cock (dvggp), pvc pipe of 4kg /cum 63 mm (dvggp), pvc pipe of 4kg /cum 75 mm (dvggp), bib cock 20mm nominal bore (dvggp)

CTN :39054050 Due date: 29 Mar, 202529 Mar, 2025 62.00 Lacs
Tender For bid to ras supply of arduino mega , arduino uno , respberry pi 4 , pi display , pi camera , bms , nodemcu , esp32 cam development board , power router , beaglebone ai for artificial intelligence based applications , peripheral sets for arduino or nodemcu or raspberry pi , oscilloscopes , function generator , benchtop multimeter , non contact voltage tester , micrometer , vernier calliper digital , electronic component repository , hot air gun , air compressor silent , led string light making machine , circular saw , bench drill machine , bench drill machine magnetic , hand drill machine , impact drill , pnumatic drill machine , jigsaw machines , bench grinder , chopsaw , table saw , laser cutting machine , printer vinyl cutter , angle grinder , printer laser , screwdriver set powered , wood lathe , mini desktop lathe cum milling , scroll saw machine , dremel cordless rotary tool , belt and disc sanding machine , coil winding machine motorized , nail machine , pcb power drilling machine , advanced motorized sewing machine , sheet cutter for power tools , variavle voltage power supply , power adopters , multiple adopter , smart ac plug , conference speaker , sheet cissor , sheet cutter for machining and fabrication tools , screwdriver set , tool wall covering perforator , end cutting mini plier , multi purpose bent nose plier , ratchet clamp , needle files , pipe vice , dremel multi tool kit , revet gun , electric rivet insert nut gun cordless riveting drill adaptor tool , adjustable spanner , micor chisel set , baby vice , anvil , wire stripper , linesmans pliers , cutting pliers , fencing pliers , ironworker pliers rebar pliers , locking pliers , ring spanner , socket spanner , hook spanner , radium cutter knives , spirit level , tap and die set , height gauge , magnifying glass with stand 2 no , digital microscope , digital telescope , measuring tape , measuring tape digital , techometer , glass cutter , allen key , tri square , electric clamp meter , multimeter , weighing scales , welding consumables , rust remover spray , acrylic sheets , foam sheets , aluminum channels , pcb drill bits , 3d printer filament , thinner , pu paint , pu primer , wires , pneumatic pipes , pneumatic fittings , drill bit set , revet , gypsum , c clamp , microware portable scan , 3d scanner cnc , exhaust portable , slide changer , carpentry boring bits , usb cables , lan cables , 9v batteries , tin cutter with spring , cutting mats , laser distance measurer , flashlights , gas welding , adjustablet wrench head , trolley , card machine , rechargeable lithium ion battery , hot air blower with soldering iron , shouldering rod , clothes iron , lithium battery spot welding machine , tool bins plastic with metal brackets , vacuum cleaner , robotic vacuum cleaner , filament dehydrator dry cabinet , reflow oven

CTN :39817428 Due date: 02 Apr, 202502 Apr, 2025 10.61 Lacs
Tender For construction of santhe katte work at yergera village , yergera gp, tq dist-raichur - whitening yergerasanthe2251, dry distemper yergerasanthe2251, border tiles 30 x 10 cms yergerasanthe2251, glazed tiles 300x450 yergerasanthe2251, granite stone slabs fine dressed 40 mm thick yergerasanthe2251, enamel metal paint yergerasanthe2251, ready mix primer paint ready mix red lead paint yergerasanthe2251, corbon electrodes yergerasanthe2251, anchor bolts 750mm yergerasanthe2251, base plate base plate yergerasanthe2251, gusset plates 6 mm thick yergerasanthe2251, ms angle iron 50x50x6mm yergerasanthe2251, ms angle iron 50mm x 50mm x 6mm 33 8 metre in length at 4 5 kg per metre yergerasanthe2251, unit cost as per the specification yergerasanthe2251, gravel 236 mm murrum yergerasanthe2251, casurina poles 100 150 mm yergerasanthe2251, brick yergerasanthe2251, binding wire yergerasanthe2251, tmt bars fe 500 yergerasanthe2251, plasticizer super plasticizer yergerasanthe2251, portland cement yergerasanthe2251, broken stone aggregate 12 mm to 10 mm size yergerasanthe2251, broken stone aggregate 20 mm size yergerasanthe2251, broken stone aggregate 40 mm size yergerasanthe2251, coarse sand zone iii yergerasanthe2251, granite/trap broken metal 100 mm and down size yergerasanthe2251

Central Government/Public Sector

CTN :39816460 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For supply of bricks , 10mm stone aggregates , 20mm stone aggregates , 40mm stone aggregates , coarse sand , fine sand , moorum filling material , portland cement , vitrified floor tile 60x60 cm , white cement , paint primer , distemper paint , acrylic smooth exterior paint , synthetic enamel paint , cement base wall care putty , roller brush , 100mm brush , tmt bar 12 mm 880 kg and 08 mm 250kg , binding wire , rectangular hallow section , gi plan sheet barge board upto 300 mm and gutter 600 mm over all girth , cgi precoated galvanised iron sheet , self screw , welding rod , 4 inch cutting blade , iron angle frame for door angle size 40x40x6 mm , wooden door 35 mm thick shutters , iron angle window with grill bar and glass panes fix with silicon complete all fitting accessories , tower bolt , handle , aldrop , calcium silicate reinforced with fibre and natural filler false ceiling tiles of size 595x595 mm , 4 mm dia steel wire rope lock u clamp set pu coated , aluminium with stainless steel ss coating 4 ftx 3 mtr mosquito net wire and meshs , 1.5 sqmm single core wire , 2 .5 sqmm single core wire , 6 amp switch , 6 amp socket 5-pin , 16 amp switch , 16 amp socket , ceiling rose , 1200mm ceiling fan , modular fan regulator , led tube light 20 watt , 16 amp single pole mcb , 32 amp double pole mcb , mcb box 8 way , pvc board size 9x8 inch , 25 mm casing capping , 25 mm casing capping clip , screw 1.5 inch , 6 mm pvc gatti , pvc 6 way board , insulation tap , contractor mason labour and electrician charges for construction of barrack size 20 feet x 60 feet and 5 feet veranda with brick wall plastering floor tiling false ceiling work etc bid number/ & ( * ) : gem/2025/b/6085958 dated/ + : 25-03-2025 bid document/ 2 2 1 / 43

Central Government/Public Sector

CTN :39809772 Due date: 14 Apr, 202514 Apr, 2025 NA
Tender For supply of bricks , 10mm stone aggregates , 20mm stone aggregates , 40mm stone aggregates , coarse sand , fine sand , moorum filling material , portland cement , vitrified floor tile 60x60 cm , white cement , paint primer , distemper paint , acrylic smooth exterior paint , synthetic enamel paint , cement base wall care putty , roller brush , 100mm brush , tmt bar 12 mm 880 kg and 08 mm 250kg , binding wire , rectangular hallow section , gi plan sheet barge board upto 300 mm and gutter 600 mm over all girth , cgi precoated galvanised iron sheet , self screw , welding rod , 4 inch cutting blade , iron angle frame for door angle size 40x40x6 mm , wooden door 35 mm thick shutters , iron angle window with grill bar and glass panes fix with silicon complete all fitting accessories , tower bolt , handle , aldrop , calcium silicate reinforced with fibre and natural filler false ceiling tiles of size 595x595 mm , 4 mm dia steel wire rope lock u clamp set pu coated , aluminium with stainless steel ss coating 4 ftx 3 mtr mosquito net wire and meshs , 1.5 sqmm single core wire , 2 .5 sqmm single core wire , 6 amp switch , 6 amp socket 5-pin , 16 amp switch , 16 amp socket , ceiling rose , 1200mm ceiling fan , modular fan regulator , led tube light 20 watt , 16 amp single pole mcb , 32 amp double pole mcb , mcb box 8 way , pvc board size 9x8 inch , 25 mm casing capping , 25 mm casing capping clip , screw 1.5 inch , 6 mm pvc gatti , pvc 6 way board , insulation tap , contractor mason labour and electrician charges for construction of barrack size 20 feet x 60 feet and 5 feet veranda with brick wall plastering floor tiling false ceiling work etc bid number/ & ( * ) : gem/2025/b/6082635 dated/ + : 24-03-2025 bid document/ 3 3 1 / 43
 Loading, Please wait...

Connect us via What's Up